logo mchintomounet.ga MCHINTOMOUNET.GA | Личный кабинет | Наши Контакты | Доставка товара

Mollie Molay The Duchess and Her Bodyguard


By Royal RequestCharged with the safety of the Dowager Duchess of Lorrania, Commander Wade Stevens pledged on the honor of his country to keep her safe. The beautiful Duchess May was in greater peril than she knew. And it was Wades solemn duty to keep the unpredictable royal out of trouble.But the fun-loving May wouldnt let him stay solemn. And when an assassin threatened Mays life, it wasnt duty that drove Wade to sweep her from danger into his arms. Forbidden attraction soon blazed from spark to flame. And although their different birthrights made love impossible, Wade had overcome the impossible before….

346.4 РУБ

похожие

Подробнее

Mollie Molay The Baby In Back Seat

Mollie Molay Secret Service Dad


Clear and Present…Trouble?Mike Wheeler needed to look no further than Charlene «Charlie» Norris to find the cause of the pain in his–leg. Mixing it up with a diplomat one minute, then chasing after an exotic pet the next, Charlie was an international incident just waiting to happen. The woman was pure trouble. With her long, shapely legs and cheery attitude, she had a way of turning his wellordered world upside down every time their paths crossed. Mike already had his hands full, juggling single fatherhood and a danger-filled job. Now hed pulled bodyguard duty for the free-spirited blonde who made his blood race and lonely heart stir. But was Charlie really mother and wife material? And was Mike prepared to become a secret service husband?Grooms in Uniform: Serving their country, as they follow their hearts…

346.4 РУБ

похожие

Подробнее

Annie ONeil Doctor...to Duchess?


Doctor…to Duchess? won the 2016 RoNA Rose Award!Her Duke in Shining Armour?GP Julia MacKenzie’s life is finally back on track! Fighting to save St Bryar’s Clinic has helped her to forget her heartache and make way for a new future – on her terms.Until Julia falls into gorgeous Dr Oliver Wyatt’s arms – literally – and suddenly her whole world is turned upside-down! Not only is Oliver the Duke of Breckonshire in-waiting, he’s the very man threatening to shut her practice down… and, even more worryingly, to steal her heart!

346.4 РУБ

похожие

Подробнее

Nikki Logan Bodyguard...To Bridegroom?


Her brooding bodyguard…Christmas has always been the loneliest time of the year for heiress Sera Blaise so, after a PR disaster, escaping to a desert paradise seems like the perfect solution! Until she meets her brooding bodyguard, Brad Kruger, whose delicious presence is far more distracting than reassuring!Brad learned a long time ago to listen to his head and never his heart, but watching Sera come alive in the magic of the desert makes him question his one golden rule. Will this bodyguard vow to love, honour and protect?

346.4 РУБ

похожие

Подробнее

Mollie Molay My Big Fake Green-Card Wedding


I Do…For Now.She might be the last twenty-nine-year-old virgin in Greece, but Melina Kostos did not need her overprotective father and brothers handpicking her husband! So when American businessman and single dad Adam Blake proposed a convenient marriage on her terms, she accepted. By Zeus, their bargain gave her everything she wanted: a gold band, a little girl to love and a green card.So why wasnt it enough?Because Melina wanted to break her no-touching-in-private rule and make her husband her first. Because she didnt want to be just a childs friend, she wanted to have Adams babies. Because she wanted the whole thing–big fat Greek wedding and all!

346.4 РУБ

похожие

Подробнее

Hugh Walpole The Duchess of Wrexe, Her Decline and Death

Carla Cassidy Home on the Ranch: Oklahoma: Defending Ranchers Daughter / The Rancher Bodyguard


THESE WILD WEST BODYGUARDS KNOW WHAT IT TAKES TO RIDE TO THE RESCUE! DEFENDING THE RANCHERS DAUGHTER Kate Sampson is lucky to be alive after nearly being trampled by a stampeding cattle herd–she has to be on alert every second. Professional bodyguard Zack West offers protection…and something a lot more dangerous. The sensual cowboy had branded her with his passion years ago. Now hes back, ready to claim her love all over again.THE RANCHER BODYGUARD Grace Covington had vowed never again to lay eyes on the hotshot defense attorney whod broken her heart. But when her stepfather is murdered, her sister found holding the bloody knife, Charlie Black is the only one who can help. And he seems determined to prove hes a changed man, too, capable of protecting her–body and soul.

578.96 РУБ

похожие

Подробнее

Steel Danielle The Duchess


Orphaned. Betrayed. Determined. Angelique Latham grew up at the magnificent Belgrave Castle with her father, the Duke of Westerfield, after the death of her mother. But when he dies, her half-brothers brutally deny her very existence and send her out into the world alone. At eighteen, Angelique has a keen mind, remarkable beauty and an envelope of money her late father pressed upon her. Unable to secure employment, Angelique desperately makes her way to Paris. To survive, she will need all her resources - and one bold stroke of fortune. Angelique takes an unfamiliar and unimaginable path in setting up what becomes a highly successful business. But she lives on the edge of scandal; can she ever make a life for herself? From England to Paris and New York, Danielle Steel paints a captivating portrait of a woman of unquenchable spirit in The Duchess.

943 РУБ

похожие

Подробнее

Mollie Molay An Engagement Of Convenience


Employer, Enemy–Or Fiance?As a single mother of two, Lili Soule will do everything she can to save the day-care center in the building where she works, even if it means challenging Tom Eldridge, her handsome boss. She cant really afford to put her job on the line, but she also cant afford to find other arrangements for the twins.Tom Eldridge is in a bind–stuck between building management, a demanding father who wants Tom to settle down right now, and the irksome Ms. Soule. Then a chance encounter with Lili and her two children gives him an idea that will solve all his problems in one fell swoop….So just when Lili thinks shes going to have to put up the fight of her life, Tom offers her a proposal shes having trouble refusing!

346.4 РУБ

похожие

Подробнее

Sheryl Lynn The Bodyguard


Broad shouldered and impressive: Everything a bodyguard should be–and more!J. T. McKennon was all a man was supposed to be. Loyal, strong, responsible and determined–not to mention the way he could kiss. As a bodyguard he was the ultimate protector. But as far as Frankie–dont call me Francine–Forrest was concerned, he was nothing but trouble.With her bad-seed brother-in-law dead, her sisters kidnappers expecting a hefty ransom and the FBI investigating her, Frankie had to rely on McKennons expertise to root out the abductors, his strength to keep her safe. But protected in his embrace, was her heart in the gravest danger…?Elk River, ColoradoWhere men still stand tall–and know how to treat a woman.

113.85 РУБ

похожие

Подробнее

Lena Diaz The Bodyguard


SHE HAD NO ONE TO FIGHT FOR HER – UNTIL ONE POWERFUL BODYGUARD REFUSED TO LEAVE HER SIDE Her perfect marriage was a sham and Caroline Ashton had the physical and emotional wounds to prove it. With nothing left to lose, Caroline is ready to walk away – and hires Luke Dawson as her personal bodyguard. But before he can do more than secure her a safe house, Caroline stumbles upon the body of the man she’d fought day and night to escape. Now, confronted with fears beyond anything she ever imagined, Luke is the only man she can trust. Putting her life in someone else’s hands isn’t easy, but Caroline knows survival never is. Besides, Luke’s proven himself to be a worthy protector – one who’ll stop at nothing to see she never suffers again.[unknown-8230]

113.85 РУБ

похожие

Подробнее

Karin Baine From Fling To Wedding Ring


She thinks she wants no strings……can sexy surgeon Ben change her mind?Nurse Mollie Forrester has a reputation as an ice queen, and the scars from a childhood accident have convinced her no man could love her. When she’s paired with handsome surgeon Ben Sheridan in a dance competition, Mollie discovers he’s not the playboy everyone thinks he is. She finds passion in his arms – but can Ben persuade Mollie she’s worthy of love?

113.85 РУБ

похожие

Подробнее

Lynna Banning Her Sheriff Bodyguard


‘Ladies unite. Votes for women!’Caroline MacFarlane has one mission in life. The pain she experienced at the hands of her father is numbed when she stands on stage and teaches the world that women are just as strong, rational and capable as men!But when her safety is threatened, suddenly protective Sheriff Hawk Rivera is glued to her side, day and night! This unexpected bodyguard has Caroline’s life in his hands, and she’s surprised to find that Hawk’s commanding presence is not just reassuring, but enticing too…

346.4 РУБ

похожие

Подробнее

Sally Wentworth Mission To Seduce


Her personal bodyguard Allie had teased him, insulted him, but still she seemed to be stuck with Drake Marsden as her official chaperon! Hed been appointed to look after her during a crucial assignment in Russia, and he refused to leave her side – day or night… . Just because Allie was pretty and petite didnt mean she needed Drakes protection!And she simply refused to be seduced by him. At least, that was the idea. Until her twenty-four-hour bodyguard decided the safest place for her was in his bed!

346.4 РУБ

похожие

Подробнее

Mollie Molay The Groom Came C..


The groom is always the last to know…Imagine confirmed bachelor Ben Howards surprise when he opened the morning paper and discovered he was about to marry a total stranger! The explanation: bridal shop owner Melinda Carey had accidentally released an imaginary engagement announcement. The thing Ben didnt get: why shed chosen him as her fake fiancée!Could life be any more embarrassing? Mortified, Melinda had secretly dreamed about marrying her high school crush. Now their «wedding» was the talk of the town, her loopy aunt Bertie was convinced canceling it would be bad luck–and most shocking of all!–Ben declared his intention to go through with the marriage.Happily Wedded After: Jump headlong into these unforgettable stories about saying «I Do!»

346.4 РУБ

похожие

Подробнее

Anne Herries The Disappearing Duchess: Duchess / Mysterious Lord Marlowe


As new wife to the Duke of Avonlea, shy and beautiful Lucinda has gained acceptance and protection–surely her harrowing past is finally behind her? Then Lucinda receives word from her enemy, and she must flee to save her husband from scandal…Justin is devastated by the disappearance of his young duchess–a woman, it seems, he doesnt know at all! How dares Lucinda think she can play him for a fool? He will not rest until he has brought his unwilling bride back to their matrimonial home…Secrets and ScandalsNothing stays secret for long in Regency Society

463.03 РУБ

похожие

Подробнее

Mollie Molay Commanders Little Surprise


A precious reminder of her one fall from grace…Baranovian royal Victoria Bernards cherished daughter had the same dimple and sparkling eyes as her father, a man forever forbidden to Victoria. She should never have seen him again–except she was assigned to diplomatic duty at Lieutenant Commander Dan OHaras JAG post! She only hoped Dan would not recognize her…Dan was a commander with a five-year plan, with marriage and kids far off in the future. But something about Victoria reminded him of the mystery woman with whom hed spent one tantalizing night. It was crazy to think this off-limits royal might be her. Honor demanded he walk away–until he saw Victorias baby girl, and his five-year plan became five seconds to fatherhood!

288.78 РУБ

похожие

Подробнее

Купить смеситель с изливом keuco moll 52720010100 за 35 259 ...

Предлагаем купить смеситель с изливом keuco moll 52720010100 в Москве по самым выгодным ценам. Гарантия от ... Модель, 52720010100. Материал ...

Детская мебель Детские столы Moll

Модель "Детские столы Moll". Регулируемые по высоте детские столы Moll. Ваш малыш больше не будет сутулиться из-за слишком низкого стола или высокого стула! Преимущества: Подвижность в сидячем положении, что особенно важно с точки зрения ортопедии. Плавное изменение угла наклона столешницы парты Moll. Комбинации столов с возможностями дополнительного оборудования и расширения. Приятный подбор цвета и декора.

Keuco Collection Moll коллекция | Аксессуары, Смесители

Рейтинг: 5 - 1 голос<br />Современная коллекция Keuco Collection Moll наглядно демонстрирует тот факт, что сегодня не ... Коллекция: Collection Moll ... Артикул: K52720010100.

MOLL - Детская мебель из Германии, купить немецкие парты ...

Компания Стелс предлагает полный выбор мебели фабрики Moll для детей в нашем интернет ...

Download the hORFeome V8.1 list - BCCM

638, ORF81007-G08, pENTR223-KIAA0101, 81007, G08, KIAA0101, KIAA0101 ...... keratin associated protein 4-1, 52720, 384, BC103846.2, LT733502, 85285 ...... pENTR223-MALL, 81012, F02, MALL, mal, T-cell differentiation protein-like ...

Растущий стул Pondi – купить в Воронеже и Липецке...

Детская мебель Moll является использованной но тщательно отборной, ухоженной, и в очень хорошем состоянии ! Для каждого набора можно отдельно подобрать ортопедический стул. - Почему мебель должна расти вместе с ребенком? Чтобы быть здоровым и правильно учиться, ребенок не должен подстраиваться под мебель - пусть мебель подстроится под него. Дети растут. И мебель moll «растет» вместе с ними, учитывая актуальный рост ребенка.

Стулья Moll Maximo, Scooter, S6 здесь / moll.com.ru

Детский стул Moll. У немецкой компании детские стулья представлены двумя моделями: Maximo 15 и Scooter 15 . Оба стула имеют сменные чехлы для сиденья и спинки, сиденье может быть отрегулировано по высоте и глубине, спинка в свою очередь регулируется по высоте. Две модели детских стульев Moll могут вращаться, но только Maximo 15 имеет блокировку вращения.

Table S1

3211, [email protected]_4523_KIAA0101, [email protected], KIAA0101 ...... 4018, [email protected]_52720_KRTAP4-1, [email protected], KRTAP4-1 ...... [email protected], MALL, TATAACACGGAGGCAAATAGGACAAATGAA, BC003179.1, 462.

ГОСТ Р 53674-2009 Арматура трубопроводная. Номенклатура ...

Дата введения — 2011—01—01 ... ГОСТ Р 52720—2007 Арматура трубопроводная. ... В настоящем стандарте применены термины по ГОСТ Р 52720. ...... IT-mall. 14. ГОСТ Р 53674—2009. Приложение Ж. {рекомендуемое).

Traffic Volume Report New York State Department cof Transportation

25 июл. 2011 г. - 0101. 0579. 0581. 0580. 0581. 0582. 0131. 0583. 0584. 0585. 0016. 0586. YR. County. Order ...... 52720. 51800. 56520. 46600. 65050. 50800. 51960. 38610. 3770. 3410. 5330. 4920 ...... MALL BLVD. JAMESTOWN WEST ...

Приставки и дополнения moll Joker Екатеринбург

Купить дополнительные элементы Moll Joker! Доставка по России!

Annual - SEC.gov

7 мая 2009 г. - 0101. 001. C10ntI. 3UI. 13. 2308 an bird. rIo nt. MoNo rt. Nc kw. 10. WI lddr ...... of particular store within the mall the other tenants occupying space at ...... 155881. Advertising and other revenue. 87493. 75554. 52720. Total.

Купить мебель и спортивные комплексы для школьника в Москве

Предлагаем купить фирменную мебель для школьников и детские спортивные комплексы из ...

Здесь найдется все!

Экспериментальная система поиска. Программно-аппаратный комплекс с веб-интерфейсом ...

ART CKS 012111 - Notepad - City of Muscatine

1000.1521.52720. 407866 25207. P 248. 00017 ...... 1000.1313.65230. 407289 319 D42-0101. P 247 ..... 2,429.92 *VENDOR TOTAL. PC MALL GOV INC.

Детский стул от Kettler | Каталог

Кресло BERRI FREE. Артикул: 6726-0ХХ. 51.899,00 руб. 39.990,00 руб. 51.899,00 руб. 39.990,00 руб. 49.499,00 руб. 35.990,00 руб. Кресло Berri Free X. Артикул: W20102-ХХХХ. Стул Chair. Артикул: 6725-ХХХ. Стул Chair. Артикул: 6725-ххх. 35.990,00 руб.

Полка Keuco Collection Moll 12757 белая купить по низкой цене в ...

Полка Keuco Collection Moll 12757 белая в интернет-магазине Сантехника. Характеристики, фото, описание. Покупайте с установкой и без! Доставка ...

Парты-трансформеры, растущие парты для дома, регулируемые ...

Парты-трансформеры (растущие парты для дома), регулируемые (растущие) и ортопедические ...

Смеситель Keuco Collection Moll 52720010100 для ванны ...

Код товара: 00166268. Артикул: 52720010100. Производитель: Keuco. Серия : Collection Moll. Модель: Collection Moll 52720010100. Страна: Германия.

Детский компьютерный стул Moll Woody M

Ретро парикмахерские парикмахерское кресло массажист верстак барный стул косметический табурет поднимаясь вращающихся стул вращающийся. 0.0 (0 голоса(ов)) Магазин: MG-purple Store.

Приставка moll joker side top poseidon-shop.ru

Боковая полка Side Top для Moll Joker применяется для расширения рабочей зоны парты сбоку;Полка может быть установлена на различной высоте ...

KEUCO, Collection Moll Корзинка для душа, белая — Главная ...

KEUCO, Collection Moll Корзинка для душа, белая. Производитель: KEUCO. Артикул: 12758 010000. Цвeт отделки: хром. Тип монтажа: подвесные.

Запчасть 1224 - Купить в Барнауле! Цены. Фото автозапчастей

... IB4129, DAC3874003633, 713618020, 713618150, RL1216, RL1224, 330364, 38BWD15AJB01, DAC40700043, 9036938002, 9036938001, 52720M2010, .

Полка Keuco Collection Moll со стеклоочистителем, белая купить ...

Интернет-магазин Гидромаркет предлагает купить товар Полка Keuco Collection Moll со стеклоочистителем, белая по цене 10120 руб. ☆ Бесплатная ...

Conselleria de Justícia, Administració Pública, Reformes ... - DOGV

13 июл. 2018 г. - escala auxiliar de gestión, C2-01-01, sector administración general para el personal de la Administración de la Generalitat, disponen que trans ...

Keuco Moll 52720010100 – купить смеситель, сравнение цен ...

Смеситель Keuco Moll 52720010100 ✓ Купить по лучшей цене ... Каталог Keuco 2019 - новинки, хиты продаж и самые актуальные модели Keuco.

Official PDF , 506 pages - World Bank Documents

2011. 2021. 71-81 81-91 91-01 01-11 11-21. Kathmandu MC ...... 13,52,720. 527,620. 504,500. 320,600. 31,000. 6,500. 7500. 17,000. 71,500. 21,500. 50,000 ...... and houses in the city can further be defined as Mall as, the Shahs and the ...

annual - Regina Apostolic Church

19 мар. 2017 г. - Income Statement from 01/01/2016 to 12/31/2016 ...... Christmas Kettle Campaign at the Southland Mall in December, as well as prepared meals for families ..... 52,720. 56,634. 63,000. Sundry (Board portion). 79,170. 64,513.

ADVISORSHARES TRUST Annual Report June 30, 2017 - 48

28 авг. 2017 г. - exposure to Retail loan names. The weakness in mall-based retailers has moved to the rest of retail as ...... 52,720. Household Products/Wares — 1.4%. ACCO Brands Corp.*. 1,223. 14,248 ...... Inc., 7.00%, 01/01/22‡. 155,000.

Полка Keuco Collection Moll со стеклоочистителем, белая купить ...

От 6 910,00 ₽ до 9 160,00 ₽ - В наличии<br />Полка Keuco Collection Moll со стеклоочистителем, белая купить по лучшей цене в нашем интернет магазине 9160р. заказ по телефону 8 495 665 70 ...

АРМАТУРА ТРУБОПРОВОДНАЯ ДЛЯ АТОМНЫХ СТАНЦИЙ ...

... к крнтнчос-нм откати дла Л М0^>Ь1^ибю1аЮШС И^>СЖН>^ (в ь а 1чнк: Адрес Гс-1- фв (mall I'aipaP отчик InaciJBiiuiKl продукции: Адрес Тем. факс 87.

Детские стул moll - регулируемые стулья (трансформер)

Официальный сайт партнера moll в Южном федеральном округе. Для жителей Волгограда. +7 (8442) 33-16-26. +7 (902) 3-125-135. Для остальных регионов. +7 (902) 3-125-135. Каталог. ... Купите качественные регулируемые стулья moll для правильной осанки вашего ребенка. © DERROSSI, 2014. 400131, г. Волгоград, ул. Коммунистическая, 10 Телефон: +7 (8442) 33-16-26 +7 (8442) 33-16-39 +7 (961) 697-00-44 [email protected]

NGC 2029 - Astronomy-Mall.com

... some brighter stars including mag 9.0 HD 52720 appears detached to the NW. ...... MCG -01-01-007 is extremely to very faint, very small, slightly elongated ...

MOLL Кресло вращающееся Maximo Fresh 351611 - Москва

Кресло Стул Бюрократ KF-2 / Or-07 вращающийся коричневый Or-07 искусственная кожа 935084 ОГО! 3190 р. Купить. Кресло Стул Бюрократ KF-1 / INDIGO26-21 вращающийся синий 26-21 664159 ОГО! 2590 р. Купить. Кресло Стул Бюрократ KF-2 / Or-21 вращающийся бордовый Or-21 искусственная кожа 935091 ОГО! 3190 р. ... Keuco Collection Moll 12755 019000 хром Интернет Сантехника. 6167 р. В корзину. Keuco Collection Moll 12701 010600 хром Интернет Сантехника. 6767 р. В корзину.

Стул Компьютерное кресло Nadir черное, цена 6300...

Если вы решили купить компьютерный стул или кресло - просто добавьте товар в корзину и оформите заказ. ... Купить. Компьютерное кресло Бюрократ T-9908AXSN. В наличии. Код: 244597.0. 15440 ₽. Купить. Компьютерное кресло Бюрократ MC-815-Н светло-серый/черный. В наличии. Код: 308523.0. 15786 ₽. Купить. Компьютерное кресло Бюрократ MC-815-Н черный/темно-серый. В наличии. Код: 308525.0. 15786 ₽. Купить. Компьютерное кресло Бюрократ MC-815-Н черный. В наличии. Код: 351508.0.

Вращающиеся кресла и стулья - купить...

Кресло руководителя, кресло оператора, кресло детское, стулья, компьютерный cтол с ДОСТАВКОЙ в Mstul.ru (МЕГАСТУЛ)! ... Кресло Бюрократ VIKING-8 черная с красным экокожа 6'520 руб. Кресло Бюрократ MC-201-H синяя сетка, сиденье черное подголовник 6'730 руб. Кресло Бюрократ MC-201-H салатовая сетка, сиденье черное подголо 6'730 руб. Кресло Бюрократ CH-808AXSN ткань TW черная вставки экокожа 4'270 руб. Кресло Бюрократ CH-204NX ткань синий морская тематика 2'425 руб.

Кресла купить в Москве | All-Biz Ltd

Ширина кресла - 57,5, см; Глубина кресла - 55, см; Высота кресла - 80, см; Высота сиденья - 46, см; Материал каркаса - массив бука; Материал обивки - ткань; Производитель - Мебель Китая; Цвет - white / light grey; Мягкость сиденья - мягкое; Вес - 6,4, кг...

http://mall.startdostavka.ru/product/Рождественские-наборы-8-шт ...

http://mall.startdostavka.ru/product/Рождественские-наборы-8-шт-нержавеющая- ...... http://mall.startdostavka.ru/product/L24e09-плиты-p-467-01a2-23731g-467-0101- ...... -воздухе-с-ик-52720-Высококачественные-видеодомофоны.html ...

Дополнительный Элемент Moll Приставка Moll Joker - Side Top ...

Боковая полка Side Top для Moll Joker применяется для расширения рабочей зоны парты сбоку;Полка может быть установлена на различной высоте ...

Онанизм у мужчины и женщины

Л. Я. Якобзон ОНАНИЗМ У МУЖЧИНЫ И ЖЕНЩИНЫ Для врачей и студентов Второе издание

Price - KA174.Ru

PJB141A, PARTS-MALL, Амортизатор задний левый газ Спектра Ижевск/ Шума 2, 2520, 1 ...... 52720-24000, Hyundai/KiA, ПОДШИПНИК ЗАДНЕЙ СТУПИЦЫ ELANTRA (до 95г.)/ ...... FA0101, BM, ФИЛЬТР ВОЗДУШНЫЙ Creta, 490, 2.

Смесители для душа Keuco, смесители для душа: фото, заказ на ...

Смеситель термостатический Keuco Edition 11 51130 010500. Производитель: Keuco. Отложить. Смеситель для ванны Keuco Moll 52720 010100.Не найдено: 0101Смесители для ванны Keuco металлические, смесители для ...www.abitant.com › Каталог › Сантехника › Сантехника для ваннойСохраненная копияОтложить. Смеситель термостатический Keuco Moll 52773 010181. Производитель: ... Смеситель для ванны Keuco Moll 52720 010100. Производитель: ...Не найдено: 010152720(その他|業務用厨房用品) - 楽天市場https://search.rakuten.co.jp › ... › 業務用厨房用品Сохраненная копияПеревести эту страницу楽天市場-「52720」(その他<業務用厨房用品<業務用厨房機器・用品<キッチン用品・食器・ ... [BFA0101] クイジプロ スリーインワン ファンネル 74−7152 65506071527.

Приставка moll Joker - Side Top, Германия - уточнить условия ...

9 536,00 ₽ - В наличии<br />Популярная модель Приставка moll Joker - Side Top, изготовленная компанией Moll, производство Германия из качественного материала ЛДСП, ...

Keuco Moll 52720.0101 приобрести < Распродажа ~ 120x240.ru

Смеситель для ванны Moll 52720.010100 Keuco для наружного монтажа керамический картридж с автоматическим переключением ванна/душ

agenda - City of Prospect

28 авг. 2018 г. - 52,720. 52,720. Completed. Nailswoth Hall Removal Complete. Carry Forward to ...... 114 Rundle Mall. ADELAIDE SA 5000 ...... Figure 2: Prospect Fast WiFi Capture Rate – 01/01/2017 – 30/05/2018. Figure 2 shows that the ...

Компьютерные столы и кресла - avito.ru

Объявления о продаже угловых компьютерных столов и офисных кресел раздела компьтерные ...

Стулья - купить дизайнерские стулья в интернет-магазине...

Детское кресло для компьютера и занятий. Что может быть важнее здоровья ребенка и его радостных глаз? ... Нередко, в качестве подарка родители желают купить именно кресло для ребенка, так как особенно ребенку необходимо сидеть на правильном кресле при игре на компьютере или за уроками. Мамы и папы стремятся подобрать все самое лучшее, качественное и безопасное, так же не малое внимание, уделяя красоте, индивидуальным особенностям и вкусам малыша.

Invoicing Deadline Spreadsheet. - Universal Service Administrative ...

... 2015, FRONTIER COMMUNICATIONS OF AMERICA, 143001110, 01/01/2018, 7/1/2018 ...... 1921, 25421, Cedar County Memorial Hospital Medical Mall Clinic ...... 3337, 52720, Baptist Surgical Associates - Carrolton, 17188061, 2017 ...

Стулья Eames-ds style (9 видов): каталог, низкие цены...

Офисные. Табуреты. Стул Knot. Normann Copenhagen. Цена: 38300 руб. Стул Elementaree. Hay. Цена: 11200 руб. Стул Pavilion AV 4. &Tradition. Цена: от 33200 руб. Стул Soft Edge 12 Upholstery. Hay. Цена: от 37500 руб. Стул Fiber Bar Tube. Muuto. Цена: от 23600 руб. Стул Icha. Massproductions. Цена: от 41600 руб. Стул Beetle Wood. Gubi. Цена: от 70200 руб. Стул Result. Hay. Цена: 22500 руб. Стул Primo. Mattiazzi. Цена: от 22900 руб. Барный стул Soft Edge 30. Hay. Цена: 16100 руб.

Приставка Moll Side Top для Joker | Moll Киев, Украина

Навесная боковая приставка для письменного стола-парты moll Joker подарит свободное пространство и поможет поддерживать порядок на рабочем ...

Отзывы о Стул для письменного стола Ikea "Мольте"

Покупали этот стул для первоклассницы. Понравился дизайн и невысокая цена. Изначально рассчитывали, что стул будет временным, на 1-2 года, поэтому выбрали такой бюджетный вариант. Стул довольно симпатичный, ребенку понравился. Собирается легко, как конструктор. Довольно увесистый...

Столы и стулья :: Стулья для школьника :: Стул Pondi

Стул Pondi Главное свойство этого стула – его эргономичное устройство. Высоту спинки, высоту стула, а так же глубину сидения в нем можно настроить в зависимости от роста пользователя, что обеспечивает правильное положение тела ребенка во время занятий.Удо.

Sheet1 - mBio

28 июл. 2015 г. - 824, s15409, GGAGAGUUCUGGACAGCCUtt, 7851, NM_005434, MALL ...... 2371, s52720, GGAUCUAACUUGAUAUUCAtt, 390181, NM_001005323 ...... GCGUAAACCCUAUCUCUAAtt, 9768, NM_001029989, KIAA0101 ...

R Under development (unstable) (2018-05-05 r74699) -- "Unsuffered ...

11 мая 2018 г. - ... 826 3 Birrarung Marr 2015-01-01 02:00:00 2015-01-01 2 567 4 Birrarung Marr ...... 52716 52717 52718 52719 [4189] 52720 52721 52722 52723 ...... 4 9 6 Bourke Street Mall (North) 2015-02-17 05:00:00 2015-02-17 5 25 7 ...

Moll 52720 0101 - serii-vse.ru

Подпятник "Fix-O-Moll" позволяет предохранить от повреждения покрытие пола. 218 RUR. Fix-o-moll ... Смеситель для ванны Keuco Moll (52720010100).

Moll wbzx0saf9r9z.ru

Дополнительный элемент Moll Приставка moll Joker - Side Top. Боковая .... Две модели детских стульев Moll могут вращаться, но только Maximo 15 имеет блокировку вращения. ..... Смеситель для ванны Keuco Moll ( 52720010100).

Приставка MOLL Joker - Side Top - Мир Парт

Рейтинг: 4 - 1 отзыв<br />Приставка MOLL Joker - Side Top по цене . Наш телефон в Москве: + 7 (495) 151-00-60.

Annual Report 2001 - Zonebourse.com

which in turn held an interest in Europea Pall Mall Ltd. Owing to the nature of its business, ...... 30/01/01. Deutschemarks. Sabadell International Finance LTD. (1) (a) ...... 52,720. 378,213. 128,610. 301,941. 198,024. 9,934. 30,051. -. -. -. 15,025.

Детское кресло Moll Maximo Белый/Черный

Стулья и кресла. Детское кресло Moll Maximo Белый/Черный. Детское кресло Moll Maximo Белый/Черный. Товар дня. Успей купить. ... Регулируемые стулья для школьников Moll Maximo — продуманное решение для организации правильного рабочего места для ученика. При покупке подобной вещи следует обратить внимание на 2 аспекта: во-первых, стул должен быть безопасным с точки зрения эргономики, а во-вторых, он должен максимально соответствовать интерьеру детской комнаты.

Mollie molay the duchess and her bodyguard. Collection moll 12715010000 lenihlopokshop.ru

Смеситель для ванны Keuco Moll (52720010100). 45150 RUR. Keuco Moll ... в магазине Дюшес (8-495-211-73-77) ... Модель: Collection Moll 12715010000.

Растущий ортопедический стул Moll. Ребенок в восторге!

Хотите сохранить хорошую осанку ребёнку? Растущие ортопедические стулья Moll сделают это за Вас! Сделано в Германии. Гарантия до 10 лет. ... Четкие, точные и функциональные решения moll обеспечивают детям хорошо обустроенное место для работы, учебы и игры, которое в том числе учитывает их собственные предпочтения и вкусы. Доктор Дитер Брайтхекер Германия. Главная страница > Стулья. Ортопедические стулья Moll для школьника. Maximo. от 0 p.

Полка Keuco Collection Moll 12759010000 со стеклоочистителем ...

Полка Keuco Collection Moll 12759010000 со стеклоочистителем, белая купить по лучшей цене в интернет-магазине. Технические характеристики и ...

Стул с подлокотниками 620

Стул с подлокотниками 620 купить недорого в интернет магазине офисной мебели. ... Стул с подлокотниками Материал: дерево, кожа, кожзам Цвет: темный орех/черешня, коричневая/темно-зеленая Вес: 21,3 Объем: 0,38 Размеры: 52,5х63,5х100 Примечание: Каркас и подлокотники – дерево темный орех/черешня, кожа-сплит коричневая/темно-зеленая, обивка – декоративные гвозди. Дизайн проект. Доставка в срок.

Стул-кресло - 2 499 руб., в Москве на аналоге Юла

Стул-кресло. В наличии 2 шт. Состояние идеальное, практически новые - в использовании были всего 1 месяц. Современная дышащая обивка. Цвет... ... Стул-кресло. В наличии 2 шт. Состояние идеальное, практически новые - в использовании были всего 1 месяц.

Простой Ресторанный Стул Пластиковый Стул...

Стул из столового гарнитура. Общее использование: Мебель для дома. ... Включающ Ретро стиль и простоту в структуре дизайна, этот набор кресло будет красиво приспособиться к любому d & eacute; cor. Особенности.

Полка Keuco Collection Moll со стеклоочистителем, антрацит ...

Keuco Collection Moll со стеклоочистителем, белая, 8 840 р. белый / хром, глянцевая / матовая, hi- ... Другие товары из коллекции Keuco Collection Moll ...

Детские компьютерные ортопедические кресла и стулья...

Купить надежное и удобное кресло компьютерное детское Вы сможете в нашем интернет-магазине «Компьютерные кресла» в Москве. Тел.: +7 (495) 727-77-82. К Вашему вниманию: бесплатная доставка в кротчайшие сроки, привлекательные цены, широкий ассортимент и высокое качество обслуживания.

Return of Private Foundation

For calendar year 2013, or tax year beginning 01-01-2013. , and ending 12-31-2013 ... 52,720. 2,636. 0. 50,084. W c Other professional fees (attach schedule) . . . . 19. 175,657 ...... NEWYORK,NY 10036. BROADWAY MALL ASSOCIATION.

o. o . o. o - FoundationSearch

Number and street (or PObox number If mall IS not delivered to street address). I Room/sUite B Telephone number ...... P 01/01/16 12/31/16. P 01/01/15 12/31/16.

mobile equipment and wind energy solutions - MOLL-MOTOR

52720. 32400. 26320. 98. 55. 1500. 2500. 2100. 6G. 157. 64000. 56000. 52000. 52000. 32800. 26640. 70. 55 ...... SS 426 01 01. Svezia. Sweden. Schweden.

Запчасть DAC42760039 - Купить подшипник ступицы во ... - Фарпост

SAT. Аналогичен DAC42760039. 01:01, сегодняАвтотрейд ... 00:36, сегодняInterАвто. Подшипник передней ступицы (50310-3E102, 51720-2J000, 52720-1F000) .... Подшипник ступицы передней! kia carnival Parts-Mall арт. PSB-H003 ...

Мебельный центр Гранд, торговый центр, …

Как добраться до Мебельный центр Гранд: на машине: Мебельный Торговый Комплекс «ГРАНД» расположен на Ленинградском шоссе, с левой стороны, …

Download book PDF - Springer Link

DOI 10.1007/978-3-642-52720-3. ALLE RECHTE, ...... 0,367 0,586 0,250 0,620 0,101 0,702 0,0678 0,744. 2. 0,418 0,570 0,299 ...... (215) ein, So erhält mall.

Что нельзя фотографировать в ОАЭ - правила и запреты в ...

+38 (044) 500-01-01. Все агентства Сети Агентств Горящих Путевок, где можно купить путевку:http://www.hottour.com.ua/where_to_buyКружка с бамбуковой ручкой EcoWoo Для папы подставкой ...www.ausra.ru/krujka-s-bambukovoj-ruchkoj-ecowoo-dlya-papi-podstavkoj.htmlСохраненная копияСмеситель для ванны Keuco Moll 52720 0101, Burberry Body Gold, Acca Kappa Крем для лица против морщин увлажняющий 1869 50 мл, Принт картридж ...

Официальный сайт Эрготроника; Интернет магазин удобной и ...

Эргономичность и комфорт кресел. Мы стараемся найти удобный стул или кресло. Мы просто ...

the macerich company - corporate-ir.net

2 мая 2018 г. - Mall portfolio occupancy was 94.0% at March 31, 2018 compared to 94.3% at March 31, 2017 ...... Tenant and other receivables, net, (17,942, ), 52,720 ...... Tysons Corner Center (50%), 01/01/24, 4.13, %, 388,448, —, 388,448.

как выбрать стул video | Как выбрать компьютерное кресло

Коленный стул, стул балансир. Поговорим о эргономике и здоровье спины. Смотрите обзор моих эргономических,... Как выбрать компьютерное кресло и правильно сидеть за компьютером. ... Какой стул выбрать ? ▻ Скачайте книгу "Основы столярного мастерства": http://jurprime.ru/pages/sh_book ▻ Чтобы попасть...

Стулья и кресла

Купить детское крутящееся компьютерное кресло для дома в интернет-магазине, низкие цены на офисные кресла для компьютера для работы и учебы. Детские компьютерные кресла и стулья для письменного стола с быстрой доставкой по всей России!

Приставка-расширение Side Top Joker - Moll

Приставка-расширение moll Side Top Joker - это увеличение столешницы письменного стола moll Joker на 40 см! С каждым учебным годом количество ...

SLV Уличный светильник C Pol 231475 купить в Симферополе

Gernetic Иммуномодулирующая крем маска Immuno 150 мл, Porada Журнальный столик Woodstock, Смеситель для ванны Keuco Moll 52720 0101, ...

Global top 25 deals 2017

3, Time period : on and after 01/01/2009 and up to and including 31/12/2017 .... Global shopping centre manager, Sopping mall investment trust services ...... 59, Post and telecommunications, 13,730, 36,143, 222,435, 21,286, 73,871, 52,720 ...

Купить стулья в Москве от проверенных постановщиков...

Чтобы купить кухонные стулья в Москве, можно вообще никуда не ехать, а сделать заказ прямо из дома или с работы. В продаже потребитель найдет у нас буквально любой вариант стульев, которые идеально подходят под оформление Вашего помещения. Это могут быть...

Итальянская, американская, немецкая, испанская мебель в ...

Интерьерный салон №1. Интерьеры в наличии, а так же Американская мебель в наличии, немецкая ...

Коллекция Keuco Moll купить, по недорогой цене в магазине ...

Коллекция бренда Keuco Moll, недорого купить в интернет-магазине. Огромный выбор ... Смеситель для ванны Keuco Moll 52720010100 хром. 36 191.

Spring, 2005 - The Society for Siberian Irises

EK-01-01. SIB (dip.), 38" (97 cm), M. S. wine red; style arms lighter with blue midrib; ... KONCERT F MOLL (Lech Lomarnicki, R. 2004). ...... Atalissa, IA 52720.

Canadian Crime Statistics 1994 - Government of Canada Publications

the local Statistics Canada offices, or by mall order to Statistics Canada, Operations and ...... 52,720. 37,927. 18,006. 40,569. 20,660. 19,187. 21,104. 24,707. 27,268 ...... 01 01. ^ 3. <. OT OT. OT OT. < < ra « ra c. <. D . c 01 V. ^ eo. 73 U 01 0).

Купить аксессуары для ванной Keuco Collection Moll по ...

Аксессуары для ванной Keuco Collection Moll по выгодным ценам в интернет -магазине. ... KEUCO Collection Moll Угловая корзинка для душа, белая.

Регулируемый стул Moll Scooter | Moll Киев, Украина

Купить детскую мебель Moll в Украине. Регулируемый стул Moll Scooter | Moll Киев, Украина Киев. ☎ ‎+38 (050) 38 814 34‎ ☎ +38 (067) 53 738 53. ... moll — немецкое качество в каждой детали. Регулируемый стул Moll Scooter. Код товара: Н/Д. Доступность: На складе.

Смеситель для ванны однорычажный с изливом, хром Keuco ...

Смеситель для ванны однорычажный с изливом, хром Keuco COLLECTION MOLL 52720010100 – купить по самой выгодной цене. Отзывы, фото ...

Смесители черного цвета дешево - купить Смесители в Москве ...

Nova MTE35 Noveo Z0101_R Noveo Z0102_R Noveo Z0103_R Noveo Z0106_R Novita 102102447. Novita 102108925. Novita 104101130. Novita 104102447

Стул-кресло для школьника фирмы moll - Москва...

продам стул ученический MOLL MAXIMO, регулируется по высоте сиденье и спинка, а также сиденье по глубине посадки. Шкала регулировки находится на ножке самого стула. Б/у, но в хорошем состоянии, качественный неубиваемый стул. Продаю потому, что мой ребенок вырос. Есть еще такой же стул ( сине-зел.обивка), тоже в хорошем состоянии.Каждый продаю за 30% от стоимости нового. Цена: 7000.00 руб. Тел.: 8 (903) 666-0041.

Концерты для духового оркестра

Партита.РФ Первая в российской сети библиотека нот для духового оркестра Сайт работает с 1 ноября 2005 года

EPIK (English Program In Korea)|Middle School |(Paper) THAT'LL BE ...

5 февр. 2010 г. - 작성자 : bsfPiods 작성일 : 2018-11-11 01:01 IP : 178.159.37.39 삭제 ...... the perfect shopping mall what would you include Why essay writing ...

Смеситель для ванны Keuco Moll 52720 0101 купить в ...

На novokuibyshevsk.zolotoyuleyshop.ru Вы можете купить Смеситель для ванны Keuco Moll 52720 0101 по выгодной цене в Новокуйбышевске.

Стул Moll Maximo купить, заказать стул Moll Maximo: цена в

Купить стулья Moll Maximo в интернет-магазине The Furnish с доставкой по Москве и России! Заказать, всегда в наличии, акции, скидки и лучшие цены для вас! ... Вы можете выбрать и купить детские стулья moll maximo в интернет-магазине Furnish. В нашем каталоге стильной мебели – 17,714 товарных позиций от европейских и российских брендов, а цены от 340 до 828 990 рублей. Нужна доставка по Москве, Санкт-Петербургу или городам России?

Latest data - Centre for Sustainable Energy

105, 0740-0818-7660-1621-1002, 0101-2817-6620-7600-4803, 9/23/2008, 18-20, .... 10/28/2010, 21-22 The Mall, LONDON, Greater London Authority, W5 2PJ ...... Ventilation, 1,318, 370, 81, 142, 40, 0, 0, 487,660, 106,758, 187,156, 52,720.

Collection moll 12715010000 lenihlopokshop.ru

Смеситель для ванны Keuco Moll (52720010100). 45150 RUR. Keuco Moll ... в магазине Дюшес (8-495-211-73-77) ... Модель: Collection Moll 12715010000.

Полка Keuco Collection Moll со стеклоочистителем, белая 12759 ...

Доступные цены на Полка Keuco Collection Moll со стеклоочистителем, белая в интернет-магазине SantPrice.ru. Большой выбор, скидки. Вы можете ...

Стулья: Купить в Москве - цены в магазинах на Aport.ru

Новинка от Moll - стул с уникальными возможностями! Глубина и высота сиденья, высота спинк. 44 063руб. + отзыв о магазине. В магазин Купить в "MyMoll.Ru". ... Кресло для геймера Aerocool AC220 AIR-BG , черно-з Кресло для геймера Aerocool AC220 AIR-BG , черно-зеленое, с перфорацией, до 150 кг, размер, см (ШхГхВ) : 66х63х125/133. Aerocool 4713105968415. 17 200руб. + отзыв о магазине. В магазин Купить в "ОЛДИ".

The Newfoundland and Labrador Gazette - Service NL

17 мар. 2006 г. - HCK Holdings Limited. 2005-11-08 52720 ...... 2006-01-01 38623 MACLEOD SAWING & DRILLING LTD. 2006-01-03 11560 ...... Millbrook Mall.

Приставка moll Joker - Side Top – Официальный сайт moll в ...

Боковая навесная полка Side Top для письменного стола moll может монтироваться на различной высоте как с левой, так и с правой стороны стола.

Прайс

PJAR003, PARTS-MALL, Амортизатор задний газовый Sonata VI (NF 2005 - 2010), 1950, 2 ...... 52720-24000, Hyundai/KiA, ПОДШИПНИК ЗАДНЕЙ СТУПИЦЫ ELANTRA (до 95г.)/ ...... FA0101, BM, ФИЛЬТР ВОЗДУШНЫЙ Creta, 380, 1, 0.

Приставка Side Top (для Joker) - Детская мебель moll в Волгограде

Прямоугольная боковая приставка для детских письменных столов Joker позволит дополнительно расширить стол на 40 см. Крепить данную приставку ...

Корзинка для душа Keuco Collection Moll белая за 6700р ...

Корзинка для душа ☆ Keuco Collection Moll белая ☆ - цена 6700р ➀ Официальный дилер Keuco ➁ Германия ➂ Характеристики ➃ Видео ➄ Отзывы ➅ ...

Стул Груп - импортер и производитель мебели на...

В интернет-магазине Стул Груп вы сможете купить мебель на металлокаркасе по самым низким ценам в Москве. Доставка по России, широкий ассортимент и высокое качество стульев и столов для вашего дома и офиса.

IMDb: Birth Date between 1860-01-01 and 1914-12-31 (Sorted by ...

Birth Date between 1860-01-01 and 1914-12-31 (Sorted by Popularity Ascending) .... 52,720. Anna Obukhovich. Actress | Vperedi - krutoy povorot .... known for Seventeen (1916), Heart of Gold (1919) and The White Moll (1920). He died on ...

near Ike - IP Mall

14 февр. 2018 г. - 52720, 52730 and 50451, I am advised that the drawings were made after each ... With respect to the enclosed JFD drawings 11881-0101 and.

Prop Class Parcel # Land Building Total PRV Total Tax Payer Tax ...

01-01-203-015 $212,760. $936,400 ...... 03-26-105-004. $52,720. $414,360. $467,080. $0. PVIP ELMHURST II LLC. 3062 ...... PNORTHLAND MALL LTD. 5030.

Стул Eames DSW - низкая цена и быстрая доставка!

Глубина и высота сиденья, высота спинки регулируются без усилий (имеется шкала);Сиденье и спинка специальной формы, особо подходящей для детей;Чехлы легко снять и постирать, либо заменить на новые;Сиденье оборудовано амортизаторами для лучшей динамики при сидении и большего комфорта;Стойка стула оснащена удобной ручкой;Широкая пятилучевая крестовина обеспечивает стулу устойчивость и безопасность...

DVTestLib/Data/USA_Housing.csv (rajacode) - Microsoft Azure ...

... Nicholas Mall Apt. 058 East Danielle, OR 53708" 70805.61068360135 ...... Mill Ashleychester, IN 02878-0101" 82816.56093860955,5.087438796538176 ...... AA 52720" 72583.25333779282,6.5218210373448136,5.773618813540487 ...

Купить детскую мебель Moll в интернет-магазине...

Детская мебель от производителя Moll купить в интернет-магазине Kinder-Aktiv в Москве. Заказ на сайте и по тел. +7 (495) 974-33-80. ... Существует такое крылатое выражение: «все начинается со школьной скамьи». Удобная, современная и комфортная парта обеспечивает ребенку благоприятную атмосферу на уроках, правильную посадку, а также возможность хорошо усваивать информацию.

Lisa Childs Groom Under Fire


I NOW PRONOUNCE YOU…BODYGUARD AND WIFE?When her real groom is kidnapped, Tanya Chesterfield convinces bodyguard and all-time crush Cooper Payne to marry her in order to fulfill the terms of her inheritance and secure a possible ransom. But when there are no demands for money, only attempts made on Tanyas life, Coopers protective instincts go into overdrive. Nearly losing her makes Cooper realize he never stopped loving her, and their pretense as husband and wife resurrects the passion between them. Cooper has vowed to honor and cherish her, and he is determined to find the truth–even if it means in the end he must let Tanya go.

346.4 РУБ

похожие

Подробнее

Peggy Nicholson Her Bodyguard


In a sumptious Newport Mansion…Gillian Mahler has a plan–take the job as soap opera star Lara Cordays personal assistant. Maybe she can endear herself to Lara first, then spring the news that Lara is her birth mother, who abandoned her as an infant twenty-eight years before.Trace Sutton has a plan, too–work undercover as a bodyguard, posing as Lara Cordays gigolo. Maybe then he can discover the identity of the faceless stalker who wants Lara dead.In Laras sumptuous mansion high on a cliff above Newport, Rhode Island, Gillian and Trace meet–and attraction sparks right away.This certainly complicates their plans.Gillian cant possibly allow herself to fall for a man whos her long-lost mothers lover, and no way can Trace blow his cover as bodyguard–especially when some sleuthing reveals that Gillian has an excellent motive for murdering the woman hes guarding!

113.85 РУБ

похожие

Подробнее

Mollie Molay Bachelor-Auction Bridegroom


A thunderous crack of the auctioneers gavel and $350 later Emily Holmes «owned» Bachelor #46, all six gorgeous feet of him! T. J.Kirkpatrick was going to have to pony up more than dinner and a movie, though. Emily needed a husband–her inheritance depended on it. T.J. insisted that he was no spousal specimen, but if being «married» meant playing newlyweds, then hed happily masquerade as Emilys man. The charade proved all too real, for T.J.s kisses made her heart race–and time stand still. And now that shed unexpectedly fallen madly in love with her «husband,» she intended to get them going…going…gone–right to the preacher!

288.78 РУБ

похожие

Подробнее

Elle James Dakota Meltdown


24/7For investigator Brenna Jensen, snowy Riverton, North Dakota, was the ideal home–until it became the target of a serial killer. Not even FBI hotshot Nick Tarver could keep her from trailing the maniac who taunted her, shadowed her every move. Brenna was anything but comfortable with Nick, her bodyguard in black leather. The sexy lawman challenged her wounded heart. But as the snow melted and the body count rose, Nicks arms became her only refuge. For Brenna had uncovered the hit list–and her name was next….

113.85 РУБ

похожие

Подробнее

Bangs John Kendrick Mollie and the Unwiseman Abroad

Nicole Helm Wyoming Cowboy Bodyguard


Her bodyguard was murdered. Will she be next? Following her scandalous divorce, fans turned on country music “bad girl” Daisy Delaney. Now someone wants her dead. But ex-FBI agent Zach Simmons isnt letting this violent psychopath get any closer to Daisy. Because this bodyguard will do whatever it takes to protect the bad girl hes falling for.

329.07 РУБ

похожие

Подробнее

PENNY JORDAN Fantasy For Two


Opposites attract!Just what did impulsive Mollie Barnes and powerful landowner Alex Villiers, Earl of St. Otel, have in common? Mollie always championed the underdog, while Alex represented the privileged classes. He declared she was stubborn and willfully determined to believe the worst of him, while she thought he was simply amusing himself with her.So why had she confessed her secret fantasy to him? It soon became clear that they shared the same dream and Alex was perfectly happy to make it come true.

138.14 РУБ

похожие

Подробнее

Ruth Dale Jean Trading Places


The best, plan of all…Alice Wynn has nothing to lose–and only fun and adventure to gain. So she agrees to impersonate her glamorous boss, Sharlayne Kenyon, who needs solitude to finish her scandalous memoirs.Jed Kilby is the bodyguard hired to protect Alice, since somebody out there will do anything to stop Sharlayne, and for the moment thats who Alice is.But Alice starts to fall in love with her unsuspecting bodyguard. And despite strict orders not to mix business and pleasure, hes falling for her, too….This is definitely not part of the original plan–but maybe its the best part of all!

288.78 РУБ

похожие

Подробнее

Bangs John Kendrick Mollie and the Unwiseman

Maria Pia Oelker A Woman In The Shadows


A historical novel set in Tuscany in the 18th century, during the enlightened government of Pietro Leopoldo of Hapsburg Lorraine. Autobiographical memories of the Grand Duchess Maria Luisa, his wife and confidante. “Vienna 1792. Maria Ludovica of Bourbon, the Spanish Infanta, for many years Grand Duchess of Tuscany and now Empress of the Holy Roman Empire, watches impotently the sudden death of her beloved consort, Pietro Leopoldo of Hapsburg, and from that moment begins almost frenetically to rekindle, one after the other, her innumerable memories of a life, still short, but intensely lived, beside the man who, since their first meeting had fascinated and conquered her, and to whom she had been a discrete and faithful companion. Public facts are weaved together with private feelings, with joys and suffering, in a sequence of urgent events. The Empress unconsciously knows, has always known, that she cannot survive for long (Editor’s note: she will in fact die just two months later) after the death of her husband and therefore must hurry to organise her memories, to finally manage to give an answer to the most important question for her: what did she really mean to him? Only a political and dynastic link, the mother of his children, friend and confidante or the woman he loved notwithstanding everything?”

665.73 РУБ

похожие

Подробнее

Valerie Parv The Baron and Bodyguard


Playing royal bodyguard to Mathiaz de Marigny, the seductive Baron Montravel, was a temptation few women could resist. But the moment he was out of harms way, Jacinta Newnham had fled his chateau–and abandoned memories of moonlit nights that left them both weak with unfulfilled passion.Now stricken with amnesia and in danger once again, Mathiaz summoned Jacinta back to his side. Jacinta vowed to protect his life, but the greater peril was to her heart–and the haunting secret she could never reveal. When the truth surrounding Mathiazs accident–and Jacintas connection to it–surfaced, would he force her to leave, or refuse to let her go again…?

346.4 РУБ

похожие

Подробнее

Metsy Hingle The Bodyguard And Bridesmaid


Right Bride, WRONG GROOM UNDERCOVER… Protecting people was Ryan Fitzpatricks business – but being Clea Masons bodyguard was going to be pure pleasure. After all, ever since hed first laid eyes on the cool, classy business executive, he hadnt been able to think about anything except her body… .AND – IF RYAN FITZPATRICK GETS HIS WAY – UNDER THE COVERS, TOO… Of course, she didnt think she needed protection. But he knew better, and pretending he was her husband was the only way to keep her safe. And if that meant getting up close and personal with the lady, well… it was a dirty job, but somebody had to do it… .RIGHT BRIDE, WRONG GROOM:Marrying Mr. Almost-Right is all wrong, especially when the perfect man is ready to sweep you into his arms.

346.4 РУБ

похожие

Подробнее

Lilian Darcy Pregnant and Protected


For months, heiress Lauren Van Schuyler didnt know the identity of the man whod saved her life and that of her unborn child. Hed kept her calm and safe, then slipped away in the chaos of their rescue. But when she met her new bodyguard, Daniel Lachlan, her pulse leaped and her heart cried out, Its him!The handsome single father of twins tried to keep things strictly professional between them. Yet in Daniels care, Lauren felt secure and cherished as never before. As her body blossomed, so did her feelings for her reluctant hero. Could Daniels honorable intentions stand up to the fiery mom-to-bes determination to follow her heart…right into Daniels arms?

346.4 РУБ

похожие

Подробнее

Liz Tyner The Wallflower Duchess


No other woman will do for the determined Duke…To Lily Hightower, Edge is still the adventurous boy she grew up with, even though he’s now become the formidable Duke of Edgeworth. So when he doesn’t propose to her sister as everyone expects, shy Lily marches right up to him to ask why…Wallflower Lily is amazed to learn that she is the Duke’s true choice. She’s hiding a secret which, if he found out, could threaten everything. But Lily is the Duchess of his dreams -and Edge is determined to make her his!

346.4 РУБ

похожие

Подробнее

B.J. Daniels Stolen Moments


She needed protection for herself–and her baby…With ebony hair and bottomless eyes, Seth Gantry was the kind of man Olivia «Levi» McCords father warned her about–and the last man on earth shed ever fall for. Especially after the sinewy cowboy kidnapped her.Seth claimed to be her bodyguard and that he needed to take her to a safe house. But when the Montana mountain cabin blows up, he becomes all that stands between Levi and an untimely death. Running for their lives and with no one to trust, Levi is at the mercy of the sexiest man shed ever met. Suddenly she isn’t certain whether the real danger comes from the killer on her trail…or the virile cowboy whos vowed to keep her alive.

463.03 РУБ

похожие

Подробнее

Donna Young Black Ops Bodyguard


It didnt matter where Calvin West laid his head.No country could keep him under its thumb. No woman could pin him down. Cool and unpredictable, Cal had a dangerous side that grew the more missions he took. And this time, his orders were coming from an old flame…. Julia Cutting may have worked for the president, but she faced a dilemma the executive office couldnt solve.So, despite her better instincts, she turned to her ex-lover—the man she knew had grown distant. But with a gun and a plan, Cal was a man she could trust with everything but the true reason for crossing enemy lines. Like the danger she found herself in, this was one bodyguard who would never leave her side, or stray far from her thoughts…

113.85 РУБ

похожие

Подробнее

Laurie Grant The Duchess And Desperado


Morgan Calhoun Was A Wanted Man Morgan knew he would someday prove his innocence, but for now Sarah Challoner needed his protection, and he was determined to guard her with his life… even if it meant loosing both his freedom… and his heart!Sarahs lofty title had proven to be of little use in the rugged lawlessness of the American West, and when exrancher Morgan Calhoun offered her his help, she could only hope that her faith in the desperate man was not a mistake she would later regret!

346.4 РУБ

похожие

Подробнее

Dana Marton The Socialite and the Bodyguard

Комментарии



Подпишитесь на новые товары в mchintomounet.ga